Online Inquiry
ADRA1A Knockout Cell Line
SPL-00118
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 10bp deletion |
| Target Information | |
|---|---|
| Target Name | Adrenergic Receptor |
| Gene Abbr. | ADRA1A |
| Gene ID | 148 |
| Full Name | adrenoceptor alpha 1A |
| Alias | ADRA1C, ADRA1L1, ALPHA1AAR |
| Species | Human |
| Genomic Locus | chr8:26864684 |
| Transcript | NM_000680 |
| WT Expression Level | 0.08 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Alpha-1-adrenergic receptors (alpha-1-ARs) are members of the G protein-coupled receptor superfamily. They activate mitogenic responses and regulate growth and proliferation of many cells. There are 3 alpha-1-AR subtypes: alpha-1A, -1B and -1D, all of which signal through the Gq/11 family of G-proteins and different subtypes show different patterns of activation. This gene encodes alpha-1A-adrenergic receptor. Alternative splicing of this gene generates four transcript variants, which encode four different isoforms with distinct C-termini but having similar ligand binding properties. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of ADRA1A. |
| Description | 10bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGCCGAAGGCCCAGTAGCCT |
| PCR Primer |
Forward: GAACAGGGGTCCAATGGATATGA Reverse: TAACATCCTAGTGATCCTCTCCGTA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.