Adam9 cDNA ORF Clone, Mouse, N-His tag - CD BioSciences

service-banner

Adam9 cDNA ORF Clone, Mouse, N-His tag

Adam9 cDNA ORF Clone, Mouse, N-His tag

SPD-00361

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse a disintegrin and metallopeptidase domain 9 (meltrin gamma) with N terminal His tag.
Target Information
Species Mouse
Target Name ADAM9
Gene Abbr. Adam9
Gene ID 11502
Full Name a disintegrin and metallopeptidase domain 9 (meltrin gamma)
Alias AU020942, MDC9, Mlt, Mltng, mKIAA0021
Introduction The ADAM (A Disintegrin and A Metalloprotease) family of multidomain membrane proteins influences cell signaling and adhesion by shedding cell surface proteins such as cytokines and growth factors, by influencing cell adhesion to the extracellular matrix (ECM), and by directly remodeling the ECM. Conserved domains in ADAM family members include a prodomain, a zinc-dependent metalloprotease domain, a disintegrin domain, a cysteine-rich domain, an EGF-like sequence, and a short cytoplasmic tail.The prodomain is thought to aid in protein folding. Disintegrin and cysteine-rich domains mediate adhesion, at least in part, through binding to integrins. Phosphorylation of the cytoplasmic tail as well as its interaction with other signaling proteins may influence intra- and extracellular signaling. ADAM9 is widely distributed and has been shown to affect migration in skin keratinocytes. Research studies have shown that ADAM9 is overexpressed in prostate cancer pancreatic cancer gastric cancer and has been linked to invasion and metastasis in small cell lung cancer. Research has also shown that an alternatively spliced short (50 kDa) form of ADAM9 containing protease activity is involved in tumor cell invasion.
Product Details
Description Full length Clone DNA of Mouse a disintegrin and metallopeptidase domain 9 (meltrin gamma) with N terminal His tag.
NCBI Ref Seq NM_007404.2
RefSeq ORF Size 2574 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-SP-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Restriction Sites KpnI + NotI (6kb + 2.57kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.