ADAM22 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

ADAM22 cDNA ORF Clone, Human, untagged

ADAM22 cDNA ORF Clone, Human, untagged

SPD-00334

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human ADAM metallopeptidase domain 22.
Target Information
Species Human
Target Name ADAM22
Gene Abbr. ADAM22
Gene ID 53616
Full Name ADAM metallopeptidase domain 22
Alias ADAM 22, DEE61, EIEE61, MDC2
Product Details
Description Full length Clone DNA of Human ADAM metallopeptidase domain 22.
NCBI Ref Seq BC036029
RefSeq ORF Size 1029 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.