ADAM15 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

ADAM15 cDNA ORF Clone, Human, untagged

ADAM15 cDNA ORF Clone, Human, untagged

SPD-00324

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human ADAM metallopeptidase domain 15.
Target Information
Species Human
Target Name ADAM15
Gene Abbr. ADAM15
Gene ID 8751
Full Name ADAM metallopeptidase domain 15
Alias MDC15
Product Details
Description Full length Clone DNA of Human ADAM metallopeptidase domain 15.
NCBI Ref Seq NM_207191.1
RefSeq ORF Size 2319 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites HindIII + XbaI (6.1kb + 2.32kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.