Online Inquiry
ACVR2A Knockout Cell Line
SPL-00093
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 7bp deletion |
| Target Information | |
|---|---|
| Target Name | Activin Receptor |
| Gene Abbr. | ACVR2A |
| Gene ID | 92 |
| Full Name | activin A receptor type 2A |
| Alias | ACTRII, ACVR2 |
| Species | Human |
| Genomic Locus | chr2:147896464 |
| Transcript | NM_001616 |
| WT Expression Level | 6.31 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a receptor that mediates the functions of activins, which are members of the transforming growth factor-beta (TGF-beta) superfamily involved in diverse biological processes. The encoded protein is a transmembrane serine-threonine kinase receptor which mediates signaling by forming heterodimeric complexes with various combinations of type I and type II receptors and ligands in a cell-specific manner. The encoded type II receptor is primarily involved in ligand-binding and includes an extracellular ligand-binding domain, a transmembrane domain and a cytoplasmic serine-threonine kinase domain. This gene may be associated with susceptibility to preeclampsia, a pregnancy-related disease which can result in maternal and fetal morbidity and mortality. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jun 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of ACVR2A. |
| Description | 7bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGTGAAACAAGGTTGTTGGC |
| PCR Primer |
Forward: TGTAAAACGACGGCCAGTTGGGAAGACGGTGAATTACTGA Reverse: TCAGAGTTCTCACTACTGGGT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.