Online Inquiry
ACVR1B Knockout Cell Line
SPL-00087
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | Activin Receptor |
| Gene Abbr. | ACVR1B |
| Gene ID | 91 |
| Full Name | activin A receptor type 1B |
| Alias | ACTRIB, ACVRLK4, ALK4, SKR2 |
| Species | Human |
| Genomic Locus | chr12:51975387 |
| Transcript | NM_020327 |
| WT Expression Level | 10.20 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes an activin A type IB receptor. Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I and two type II receptors. This protein is a type I receptor which is essential for signaling. Mutations in this gene are associated with pituitary tumors. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jun 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of ACVR1B. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AAAGTGGAGCTGGTCCCTGC |
| PCR Primer |
Forward: TGTAAAACGACGGCCAGTGTTTGGAAAAGGACCTGCAA Reverse: TTCTGGTCCCTCCTCACATC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.