Online Inquiry
ABCA1 Knockout Cell Line
SPL-00023
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | ABCA1 |
| Gene Abbr. | ABCA1 |
| Gene ID | 19 |
| Full Name | ATP binding cassette subfamily A member 1 |
| Alias | ABC-1, ABC1, CERP, HDLCQTL13, HDLDT1 |
| Species | Human |
| Genomic Locus | chr9:104884468 |
| Transcript | NM_005502 |
| WT Expression Level | 1.64 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. With cholesterol as its substrate, this protein functions as a cholesteral efflux pump in the cellular lipid removal pathway. Mutations in this gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of ABCA1. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GTTTCCGTTACCCGACTCCT |
| PCR Primer |
Forward: AATCCAGCCATTCAAAATTCTCCAG Reverse: TGTATAAATGGAGCCTCAAAATCGC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.